View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_low_85 (Length: 268)
Name: NF0857_low_85
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0857_low_85 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 15 - 197
Target Start/End: Complemental strand, 12316759 - 12316577
Alignment:
Q |
15 |
tatggatcaaatcctttaatcacttaataaataaagtttcttatctttacaatattattttgtattttgcctcaacagatgatgcttgatgaagcttgca |
114 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
12316759 |
tatggatcaaatcctttaatcacttaataaataaagtttcttatctttacaatattattttgtattttgcctcaacacatgatgcttgatgaagcttgca |
12316660 |
T |
 |
Q |
115 |
taaagaatacacaaagcttgtagagaattgataatacatggagtctaatgaggctctagaaagaatgcattgatcctctagag |
197 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12316659 |
taaagaatacacaaagcttgtagagaattgataatacatggagtctaatgaggctctagaaagaatgcattgatcctctagag |
12316577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 268
Target Start/End: Complemental strand, 12316578 - 12316534
Alignment:
Q |
224 |
agcttgggaaagatacataaagcttgaagatgcatataaaatact |
268 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12316578 |
agcttgggaaagatacataaagcttgaagatgcatataaaatact |
12316534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University