View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_low_92 (Length: 261)
Name: NF0857_low_92
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0857_low_92 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 26 - 222
Target Start/End: Complemental strand, 49993721 - 49993525
Alignment:
Q |
26 |
gagtggtttggatttgatgggttgattttagctattgtatgtgttttcttcgttgttgttgtgaatggtgctggtgaaaaggaaaatgagtttgatgaaa |
125 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49993721 |
gagtggtttggatttgatgggttgattttagctattgtatgtgttttctttgttgttgttgtgaatggtgctggtgaaaaggaaaatgagtttgatgaaa |
49993622 |
T |
 |
Q |
126 |
ctgaggaagaattgggtgattcaattgaagggaatgagagaaaaaagagtggtagatcatttaaaaagattgttttttcactaccttctgcttttat |
222 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49993621 |
ctgaggaagaattgggtgattcaattgaagggaatgagagaaaaaagagtggtagatcatttaaaaagattgttttttcactaccttctgcttttat |
49993525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 29 - 102
Target Start/End: Original strand, 1875276 - 1875349
Alignment:
Q |
29 |
tggtttggatttgatgggttgattttagctattgtatgtgttttcttcgttgttgttgtgaatggtgctggtga |
102 |
Q |
|
|
||||||||||| ||||| ||| ||||||| ||||| ||||||| ||| |||| ||||||||||||||||||| |
|
|
T |
1875276 |
tggtttggattagatggattggttttagccattgtttgtgtttgtttcattgtaattgtgaatggtgctggtga |
1875349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University