View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_low_96 (Length: 258)
Name: NF0857_low_96
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0857_low_96 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 39631439 - 39631687
Alignment:
Q |
1 |
tattcagaattaaaaagggagcaaaagatttccaaaaccttgacaatatatgcctttgaaacttgtttaactcataacttaaggtatgtacaactaatct |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39631439 |
tattcagaattaaaaagggagcaaaagatttccaaaaccttgacaatatatgcctttgaaacttgtttaactcataacttaaggtatgtacaactaatct |
39631538 |
T |
 |
Q |
101 |
taatactataattgattaaa-tactgatggctgatcatcttttgtttattgattaaacgtacgtggcatcttaatctccccgaaatgttaaagctcattc |
199 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39631539 |
taatactataattgattaaattactgatggctgatcatcttttgtttattgattaaacgtacgtggcatcttaatctccccgaaatgttaaagctcattc |
39631638 |
T |
 |
Q |
200 |
aaacaaattgttannnnnnnnaatatttctagtggcataatattctgtg |
248 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
39631639 |
aaacaaattgttattttttttaatatttctagtggcataatattctgtg |
39631687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University