View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_low_98 (Length: 254)
Name: NF0857_low_98
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_low_98 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 6e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 52 - 243
Target Start/End: Original strand, 40586110 - 40586301
Alignment:
| Q |
52 |
gagttacacccaaatttaacacatatagatcannnnnnnnccctttcctattacaaattaaaactaaatttcttgtcaactaactcaagaataccaatgt |
151 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40586110 |
gagttacacccaaatttaacacatatagaacattttttttccctttcctattacaaattaaaactaaatttcttgtcaactaactcaagaataccaatgt |
40586209 |
T |
|
| Q |
152 |
cagcattatcatgatcttcaatggctatattcagatccaaagagaggtttagattactttgatgatcctctatcatggtctctttccctttg |
243 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40586210 |
cagcattatcatgatcttcaatggcgatatttagatccaaagagaggtttagattactttgatgatcctctatcatggtctctttccctttg |
40586301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 40586053 - 40586082
Alignment:
| Q |
1 |
actatagctgaaaaacaaacaagttgagag |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40586053 |
actatagctgaaaaacaaacaagttgagag |
40586082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2250 times since January 2019
Visitors: 6160