View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0857_low_99 (Length: 254)

Name: NF0857_low_99
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0857_low_99
NF0857_low_99
[»] chr1 (1 HSPs)
chr1 (30-236)||(4400647-4400853)


Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 30 - 236
Target Start/End: Original strand, 4400647 - 4400853
Alignment:
30 attttgatatcagttaagtttgtgtagtttgtaaacatgattataataacaagcggtttaatttggttgcatattattgaaatggatttcttgattgtta 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4400647 attttgatatcagttaagtttgtgtagtttgtaaacatgattataataacaagcggtttaatttggttgcatattattgaaatggatttcttgattgtta 4400746  T
130 ggcttttc---tagtaattagacatgaaattaaaagttcagaaataaatggtcaattttattggcaaaaaa-aatggtcaattttggatctatttgttta 225  Q
    ||||||||   ||||||||||||||||||||||||||||||    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
4400747 ggcttttctagtagtaattagacatgaaattaaaagttcag----aaatggtcaattttattggcaaaaaacaatggtcaattttggatctatttgttta 4400842  T
226 aagtgagagtg 236  Q
    ||||| |||||    
4400843 aagtgggagtg 4400853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3407 times since January 2019
Visitors: 6174