View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0858_high_10 (Length: 211)

Name: NF0858_high_10
Description: NF0858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0858_high_10
NF0858_high_10
[»] chr1 (1 HSPs)
chr1 (30-179)||(38840729-38840878)


Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 30 - 179
Target Start/End: Original strand, 38840729 - 38840878
Alignment:
30 gttggttttggtatcaaagataatgtggctaagttggaggcaaattatggttgtggaatcataaatgctgttgaacttggacccttggctgctactgcca 129  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38840729 gttggttttggtatcaaagataatgtggctaagttggagtcaaattatggttgtggaatcataaatgctgttgaacttggacccttggctgctactgcca 38840828  T
130 tgaagaaacctcgtttggcttatatcggtgttgatgaactgctttctgtg 179  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||    
38840829 tgaagaaacctcgtttggcttatatcggtgttgatgagctgctttctgtg 38840878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University