View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0858_high_6 (Length: 355)
Name: NF0858_high_6
Description: NF0858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0858_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 7 - 352
Target Start/End: Original strand, 5674533 - 5674876
Alignment:
| Q |
7 |
gtttcgccatcgttgccaactagagaaaatttggtgtggaaaagagtattatcaaatgggggagccagggtgcgtcgtccatggtgcctgaattggtcag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5674533 |
gtttcgccatcgttgccaactagagaaaatttggtgtggaaaagagtattatcaaatgggggagccggggtgcgtcgtccatggtgcctgaattggtcag |
5674632 |
T |
 |
| Q |
107 |
aaacagagacacatgcattcactttgtgtagatttgcaagtcaaatttggtacaaaatcttaaaatggattggtgcgtcaatggttttttcgacaaattt |
206 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5674633 |
aaacagagacacatgcattcattttgtgtagatttgcaagtcaaatttggtacaaaatcttaaaatggattggtgcgtcgatggttttttcgacaaattt |
5674732 |
T |
 |
| Q |
207 |
attcaccttattgagagtatgcttagataggagaaaatcatgttcatctattttttctttgtgggtgtaattaccacttgtacttatcacaatatatgag |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5674733 |
attcaccttattgagagtatgcttagataggagaaaatcatgttcatctattttttc--tgtgggtgtaattaccacttgtacttatcacaatatatgag |
5674830 |
T |
 |
| Q |
307 |
agtagtacaccaacaaggttgcaatgcaatccaactcaagtattat |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5674831 |
agtagtacaccaacaaggttgcaatgcaatccaactcaagaattat |
5674876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University