View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0858_low_16 (Length: 285)
Name: NF0858_low_16
Description: NF0858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0858_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 9e-39; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 125 - 229
Target Start/End: Original strand, 35926031 - 35926136
Alignment:
| Q |
125 |
tcctttaattgtgaaatcaactaattctgcaaatccatgaagaatagctgcaaaaacaa-aactgtattttcccacctccttcccctcacatttcttctt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
35926031 |
tcctttaattgtgaaatcaactaattctgcaaatccatgaagaacagctgcaaaaacaacaactgtattttctcacctccttcctctcacatttcttctt |
35926130 |
T |
|
| Q |
224 |
gatgat |
229 |
Q |
| |
|
||||| |
|
|
| T |
35926131 |
aatgat |
35926136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 954 times since January 2019
Visitors: 6039