View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0858_low_18 (Length: 255)
Name: NF0858_low_18
Description: NF0858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0858_low_18 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 6 - 255
Target Start/End: Original strand, 18782285 - 18782534
Alignment:
Q |
6 |
ctccaacaatatttgtggaagtgtttgaaaatatgtttgagtacattgatcgtcttgttactattgctaagccacgcaagctattgtacatggctattgg |
105 |
Q |
|
|
||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18782285 |
ctccaacaacatttgtggaagtgtttgcaaatatgtttgagtacattgatcgtcttgttactattgctaagccacgcaagctattgtacatggctattgg |
18782384 |
T |
 |
Q |
106 |
tgagacatattaacaccaccttttacttgttttacactttagccaacctaagtggttccctaaaatagttctataaggtgtcgaacaactttaagttgtc |
205 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18782385 |
tgagacatattaacaccaccttttacttgttttacactttagccaacctaagtggttccctaaaatagttctataaggtgtcgaacaactttaagttgtc |
18782484 |
T |
 |
Q |
206 |
aaaatatattttttagtgatgttaatatagtaatttatttggttaaaaca |
255 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18782485 |
aaaatatattttttagtgatgttaatatagtaatttatttggttaaaaca |
18782534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 126 times since January 2019
Visitors: 6045