View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0858_low_21 (Length: 229)
Name: NF0858_low_21
Description: NF0858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0858_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 35034657 - 35034869
Alignment:
| Q |
1 |
caacatactcgagaaatactaatgcagctggagtgcgtagaaatgtcagcatgccgccaccaccatcaccaccatctgcattgcctatggttcaccctct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35034657 |
caacatactcgagaaatactaatgcagctggagtgcgtagaaatgccagcatgccgccaccaccatcaccaccatctgcattgcctatggttcaccctct |
35034756 |
T |
 |
| Q |
101 |
ccctccttttcaccaatatggctatataccttatggtatgaattacggttggcctaataccatgatgtggcctttattaaacatgtcgggcaataccatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35034757 |
ccctccttttcaccaatatggctatataccttatggtatgaattacggttggcctaataccatgatgtggcctttattaaacatgtcgggcaataccatg |
35034856 |
T |
 |
| Q |
201 |
atgcaacctttct |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35034857 |
atgcaacctttct |
35034869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University