View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0858_low_26 (Length: 205)
Name: NF0858_low_26
Description: NF0858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0858_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 22 - 171
Target Start/End: Original strand, 38840729 - 38840878
Alignment:
Q |
22 |
gttggttttggtatcaaagataatgtggctaagttggaggcaaattatggttgtggaatcataaatgctgttgaacttggacccttggctgctactgcca |
121 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38840729 |
gttggttttggtatcaaagataatgtggctaagttggagtcaaattatggttgtggaatcataaatgctgttgaacttggacccttggctgctactgcca |
38840828 |
T |
 |
Q |
122 |
tgaagaaacctcgtttggcttatatcggtgttgatgaactgctttctgtg |
171 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
38840829 |
tgaagaaacctcgtttggcttatatcggtgttgatgagctgctttctgtg |
38840878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 677 times since January 2019
Visitors: 6034