View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0858_low_28 (Length: 202)
Name: NF0858_low_28
Description: NF0858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0858_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 2e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 18 - 183
Target Start/End: Original strand, 35034569 - 35034737
Alignment:
| Q |
18 |
gaaagggatgctaaagatccaaaatatgtacttgttacatatgatggaaaacatacacatggacctgtcgttgataagaaaag---accaacatactcga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
35034569 |
gaaagggatgctaaagatccaaaatatgtacttgttacatatgatggaaaacatacccatggacctgtcattgataagaaaagtcgaccaacatactcga |
35034668 |
T |
 |
| Q |
115 |
gaaatactaatgcagctggagtgcgtagaaatgtcagcatgccgccaccaccatcaccaccatctgcat |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35034669 |
gaaatactaatgcagctggagtgcgtagaaatgccagcatgccgccaccaccatcaccaccatctgcat |
35034737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University