View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0859_high_20 (Length: 355)
Name: NF0859_high_20
Description: NF0859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0859_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 30 - 345
Target Start/End: Complemental strand, 41980700 - 41980385
Alignment:
Q |
30 |
aatggtactgaaaaggagccgaattattttccgatgaagctttaccaaacggcggtgacgacggaggaggagacattggagtacgaattgagtgtggacg |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41980700 |
aatggtactgaaaaggagccgaattattttccgatgaagctttaccaaacggcggtgacgacggaggaggagacattggagtacgaattgagtgtggacg |
41980601 |
T |
 |
Q |
130 |
cgaagatggactatatggtgtggctgcatttcgcggagattgattcgagtgtgaaaaaagaaggagagagagtttttgatgtgtttatcaatggaaacaa |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41980600 |
cgaagatggactatatggtgtggctgcatttcgcggagattgattcgagtgtgaaaaaagaaggagagagagtttttgatgtgtttatcaatggaaacaa |
41980501 |
T |
 |
Q |
230 |
tgtaacaagagtcgatatttacaaagaagtgggaagttttgctgcttttacttggcattatactgtgaaaaatttgagtagtaatgttttggggattaag |
329 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41980500 |
tgtaacaagagttgatatttacaaagaagtgggaagttttgctgcttttacttggcattatactgtgaaaaatttgagtagtaatgttttggggattaag |
41980401 |
T |
 |
Q |
330 |
cttgttactgtctctg |
345 |
Q |
|
|
||||||||||| |||| |
|
|
T |
41980400 |
cttgttactgtttctg |
41980385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 195 - 310
Target Start/End: Original strand, 22084350 - 22084465
Alignment:
Q |
195 |
gagagagtttttgatgtgtttatcaatggaaacaatgtaacaagagtcgatatttacaaagaagtgggaagttttgctgcttttacttggcattatactg |
294 |
Q |
|
|
||||| || ||||||||||| |||||||| | ||| | || ||||| |||||||||||| |||| || |||| ||||| |||||||||||| |||| | |
|
|
T |
22084350 |
gagagggtgtttgatgtgttcatcaatggtgataatttgactagagtagatatttacaaacaagttgggggtttagctgcgtttacttggcatcatacag |
22084449 |
T |
 |
Q |
295 |
tgaaaaatttgagtag |
310 |
Q |
|
|
|||| ||||||||||| |
|
|
T |
22084450 |
tgaagaatttgagtag |
22084465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3599 times since January 2019
Visitors: 6174