View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0859_high_22 (Length: 348)
Name: NF0859_high_22
Description: NF0859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0859_high_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 29 - 251
Target Start/End: Complemental strand, 51990708 - 51990486
Alignment:
| Q |
29 |
agaaataaagagtgagttacctgaaggtgtcgaaatggtaccagcgaggagaatcaccggtgcgagaagtggtgagcatgaagatagaggaagcaaggga |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
51990708 |
agaaataaagagtgagttacctgaaggtgtcgaaatggtaccagcgaggagaatcaccggtgcgagaagtggcgagcatgaagatagaggaagcaaggga |
51990609 |
T |
|
| Q |
129 |
gaatgaaaaagaggtgagacggaagacgaggatgagtgaattgaaacgacggagtttgtgttcagcgacggtggagtggaaacgaggggcggaaggtgaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51990608 |
gaatgaaaaagaggtgagacggaagacgaggatgagtgaattgaaacgacggagtttgtgttcagcgacggtggagtggaaacgaggggcagaaggtgaa |
51990509 |
T |
|
| Q |
229 |
cggttgttatcggcgacgccgtt |
251 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
51990508 |
cggttgttatcggcgacgccgtt |
51990486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 246 - 329
Target Start/End: Original strand, 1869499 - 1869582
Alignment:
| Q |
246 |
gccgttatcaatccacatatgttttttaaaagaaaaatgagactcttttagagcattatgtaccttacaaatgatgatgatgtc |
329 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1869499 |
gccgttatcaatccgcatatgttttttaaaagaaaaatgagactcttttagagcattatgtaccttacaaatgatggtgatgtc |
1869582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3277 times since January 2019
Visitors: 6172