View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0859_high_27 (Length: 328)
Name: NF0859_high_27
Description: NF0859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0859_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 1869543 - 1869363
Alignment:
Q |
1 |
gagtctcatttttcttttaaaaaacatatgcggattgataacggctatttatataggaatatcggaaacactctctttcttaacactctctaacagtcac |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
1869543 |
gagtctcatttttcttttaaaaaacatatgcggattgataacggct-tttatataggaatatcggaaacactctctttcttaacactctctaatagtcac |
1869445 |
T |
 |
Q |
101 |
tttcttatcgcatgaaatttagtgtggatactacaatttagaaatgtatttcatgtaaagtggtgaaacccacataagtttc |
182 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||| || |||||||| ||| ||||||||||||||| |
|
|
T |
1869444 |
tttcttatcgcatgaaatttagtgtggatactataatttagaaatgtatcccacgtaaagtgatgagacccacataagtttc |
1869363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 286 - 327
Target Start/End: Complemental strand, 1869437 - 1869396
Alignment:
Q |
286 |
tcgcatgaaatttagtgtgcatactacaatttagaaatgtat |
327 |
Q |
|
|
||||||||||||||||||| |||||| ||||||||||||||| |
|
|
T |
1869437 |
tcgcatgaaatttagtgtggatactataatttagaaatgtat |
1869396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3179 times since January 2019
Visitors: 6172