View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0859_high_49 (Length: 222)
Name: NF0859_high_49
Description: NF0859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0859_high_49 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 14 - 149
Target Start/End: Original strand, 2102486 - 2102620
Alignment:
Q |
14 |
cccttaatgtgtatgcactaacctaacttcatttattataactttatcacttaaattgtatctgaatgaattgaataatgataacattaaaagataatcc |
113 |
Q |
|
|
|||||| |||||||||| ||||||| |||||| ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2102486 |
cccttactgtgtatgcattaacctatcttcatgtattataactt-atcacttaaattgcatctgaatgaattgaataatgataacattaaaagataatcc |
2102584 |
T |
 |
Q |
114 |
gaatttaccatcatatttttattgggtttgcaacag |
149 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
2102585 |
gaatttaccatcatatttttattgggtttgcaacag |
2102620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 157 - 211
Target Start/End: Original strand, 38058421 - 38058475
Alignment:
Q |
157 |
tttgtcaaattcattttaatgtaagttctaaaacgttgcagctatacctatgata |
211 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38058421 |
tttgtcaaattcattttaatgtaagttctaaaacgttgcagctatacctatgata |
38058475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3773 times since January 2019
Visitors: 6175