View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0859_high_50 (Length: 218)
Name: NF0859_high_50
Description: NF0859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0859_high_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 33 - 195
Target Start/End: Original strand, 51755611 - 51755778
Alignment:
| Q |
33 |
ccccctccactcttaccatcaaaagttaaaagaa-----gaacacgctcacagagatgaacatgtcagaaaattctccacttgacactctagctttcaac |
127 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51755611 |
ccccctccactcttaccatcaaaagtgaaaagaagagaagaacacgctcacagagatgaacatgttagaaaattctccacttgacactctagctttcaac |
51755710 |
T |
|
| Q |
128 |
tacttgagcttcgatttcttcaaccatttatggacatggctcgccgtaatcttctggaggatcccaac |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51755711 |
tacttgagcttcgatttcttcaaccatttatggacatggctcgccgtcatcttctggaggatcccaac |
51755778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2828 times since January 2019
Visitors: 6167