View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0859_low_13 (Length: 433)
Name: NF0859_low_13
Description: NF0859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0859_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 29 - 389
Target Start/End: Original strand, 54637012 - 54637372
Alignment:
Q |
29 |
aggtggatggtatcagcaagtctgcatagatgaataagagcccagtcaaaagcatgtttactgtttggaccatgatctatggctaatactatatcccttc |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54637012 |
aggtggatggtatcagcaagtctgcatagatgaataagagcccaatcaaaagcatgtttactgtttggaccatgatctatggctaatactatatcccttc |
54637111 |
T |
 |
Q |
129 |
ctcttcttctttcccctgtttccctctcaagctctggctcaggcactattggtatcagagatggaagcttcacttctctgtagttgtattcttctacatc |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54637112 |
ctcttcttctttcccctgtttccctctcaagctctggctcaggcactattggtatcagagatggaagcttcacttctctgtagttgtattcttctacatc |
54637211 |
T |
 |
Q |
229 |
ttccatcactgtctccattaatttacaatcttcacaacttcttggattatgaactttgcnnnnnnnctttctttctgattatctctctactcaaactttc |
328 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
54637212 |
ttccatcactgtctccattaatttacaatcttcacaacttcttggattatgaactttgctttttttctttctttctgattatctctctactcaaactttc |
54637311 |
T |
 |
Q |
329 |
atatgatacggtgattactctaattaaaattaatctaatcaaaggatattatcaagtgctg |
389 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54637312 |
atatgatacggtgattactctaattaaaattaatctaatcaaaggatattatcaagtgctg |
54637372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University