View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0859_low_20 (Length: 361)
Name: NF0859_low_20
Description: NF0859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0859_low_20 |
 |  |
|
[»] chr1 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 100 - 361
Target Start/End: Original strand, 26815997 - 26816258
Alignment:
Q |
100 |
ggataatgctaacatgtgtcttaaaatatgcagaatgaagaagaaaataattatgcatgagaattgtattttacgcattattttacctgtctgctatctt |
199 |
Q |
|
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26815997 |
ggataatgctaacatgtgccttaaaatatgcagaaagaagaagaaaataattatgcatgagaattgtattttacgcattattttacctgtctgctatctt |
26816096 |
T |
 |
Q |
200 |
taatcgaggctttttgattcctttaccaccaactttacttttgagagcatctccaagtttttcagtgacaatccattcattcactcttctagtctctagt |
299 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
26816097 |
taatcgaggctttttgattcctttaccaccaactttacttttgagagcatctccaagtttttcagtgacaatccattcattcactctactagtctctagt |
26816196 |
T |
 |
Q |
300 |
agaccaataattgttgcttttgttcgatgtagagctatggtatcttcaaagagaacccaaaa |
361 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
26816197 |
agaccaataattgttgcttttgttcgatgtagagctatggtattttcaaagagaacccaaaa |
26816258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 180 - 361
Target Start/End: Original strand, 26789247 - 26789428
Alignment:
Q |
180 |
ttttacctgtctgctatctttaatcgaggctttttgattcctttaccaccaactttacttttgagagcatctccaagtttttcagtgacaatccattcat |
279 |
Q |
|
|
|||||||||||| | || || |||||| ||||||||| | ||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26789247 |
ttttacctgtctacaattttaaatcgaagctttttgagttctttaccaccatctttacccttgagagcatctccaagtttttcagtgacaatccattcat |
26789346 |
T |
 |
Q |
280 |
tcactcttctagtctctagtagaccaataattgttgcttttgttcgatgtagagctatggtatcttcaaagagaacccaaaa |
361 |
Q |
|
|
||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
26789347 |
tcactctactagtctctagcagaccaataattgttgcttttgttcgatgtagagctatggtattttcaaagagaacccaaaa |
26789428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 183 - 342
Target Start/End: Original strand, 26829766 - 26829925
Alignment:
Q |
183 |
tacctgtctgctatctttaatcgaggctttttgattcctttaccaccaactttacttttgagagcatctccaagtttttcagtgacaatccattcattca |
282 |
Q |
|
|
||||||||| | ||| | |||||| ||||||||| ||||||||||| | |||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
26829766 |
tacctgtctccaatcctaaatcgaagctttttgagtcctttaccactagctttacccttgaaagcatctccaagtttttcagtgacaatccattcattca |
26829865 |
T |
 |
Q |
283 |
ctcttctagtctctagtagaccaataattgttgcttttgttcgatgtagagctatggtat |
342 |
Q |
|
|
|||| |||| |||||||||||||||||| ||||| ||||||||||| |||| ||||||| |
|
|
T |
26829866 |
ctctactagcctctagtagaccaataatcgttgcctttgttcgatgaagagacatggtat |
26829925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 243 - 361
Target Start/End: Original strand, 26782937 - 26783055
Alignment:
Q |
243 |
agagcatctccaagtttttcagtgacaatccattcattcactcttctagtctctagtagaccaataattgttgcttttgttcgatgtagagctatggtat |
342 |
Q |
|
|
||||||| |||||||||||| ||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |||| ||||| || || ||||||| |
|
|
T |
26782937 |
agagcatttccaagtttttctgtgacaatccattcattcactctactagtctctagtataccaataattgttgcctttgctcgatttaaagacatggtat |
26783036 |
T |
 |
Q |
343 |
cttcaaagagaacccaaaa |
361 |
Q |
|
|
|||||||||| |||||| |
|
|
T |
26783037 |
tctcaaagagaatccaaaa |
26783055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 240 - 309
Target Start/End: Complemental strand, 41920927 - 41920858
Alignment:
Q |
240 |
ttgagagcatctccaagtttttcagtgacaatccattcattcactcttctagtctctagtagaccaataa |
309 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||| |||| ||| ||||||||||||| |
|
|
T |
41920927 |
ttgagagcatctccaagtttctcagtgacaatccattcattcactcgactagcctccagtagaccaataa |
41920858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 243 - 284
Target Start/End: Complemental strand, 2301259 - 2301218
Alignment:
Q |
243 |
agagcatctccaagtttttcagtgacaatccattcattcact |
284 |
Q |
|
|
||||||| ||||||||||| |||||||||||||||||||||| |
|
|
T |
2301259 |
agagcatttccaagttttttagtgacaatccattcattcact |
2301218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2888 times since January 2019
Visitors: 6167