View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0859_low_24 (Length: 348)
Name: NF0859_low_24
Description: NF0859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0859_low_24 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 94 - 348
Target Start/End: Complemental strand, 46309425 - 46309167
Alignment:
| Q |
94 |
ttcaccgtgtagtgttgatgctacataggtcaaataggttgtggaacaaattttcaaaacaagaa---actttaattaccacaggacataaactccataa |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46309425 |
ttcaccgtgtagtgttgatgctacataggtcaaataggttgtggaacaaattttcaaaacaagaagaaactttaattaccacaggacataaactccataa |
46309326 |
T |
|
| Q |
191 |
atactaacgccatatcttgccaaaaatttccaacataaacacataa-ggtgttgctatttaattacaccatacaaccatatcaacagtcacaaaataagc |
289 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46309325 |
atactaaagccatatcttgccaaaaatttccaacataaacacataaaggtgttgctatttaattacaccatacaaccatatcaacggtcacaaaataagc |
46309226 |
T |
|
| Q |
290 |
gtcgatccaaaaagtaaaataatatcttgccaaaagtttccaacataaacacataaggt |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46309225 |
gtcgatccaaaaagtaaaataatatcttgccaaaagtttccaacataaacacataaggt |
46309167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 202 - 312
Target Start/End: Complemental strand, 46309204 - 46309094
Alignment:
| Q |
202 |
atatcttgccaaaaatttccaacataaacacataaggtgttgctatttaattacaccatacaaccatatcaacagtcacaaaataagcgtcgatccaaaa |
301 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
46309204 |
atatcttgccaaaagtttccaacataaacacataaggtgttgctatttaattacaccatacaaccatatcaccgttcacaaaataagcgtcgatccaaaa |
46309105 |
T |
|
| Q |
302 |
agtaaaataat |
312 |
Q |
| |
|
||||||||||| |
|
|
| T |
46309104 |
agtaaaataat |
46309094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1107 times since January 2019
Visitors: 6137