View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0859_low_30 (Length: 328)

Name: NF0859_low_30
Description: NF0859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0859_low_30
NF0859_low_30
[»] chr4 (2 HSPs)
chr4 (1-182)||(1869363-1869543)
chr4 (286-327)||(1869396-1869437)


Alignment Details
Target: chr4 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 1869543 - 1869363
Alignment:
1 gagtctcatttttcttttaaaaaacatatgcggattgataacggctatttatataggaatatcggaaacactctctttcttaacactctctaacagtcac 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||    
1869543 gagtctcatttttcttttaaaaaacatatgcggattgataacggct-tttatataggaatatcggaaacactctctttcttaacactctctaatagtcac 1869445  T
101 tttcttatcgcatgaaatttagtgtggatactacaatttagaaatgtatttcatgtaaagtggtgaaacccacataagtttc 182  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||  || |||||||| ||| |||||||||||||||    
1869444 tttcttatcgcatgaaatttagtgtggatactataatttagaaatgtatcccacgtaaagtgatgagacccacataagtttc 1869363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 286 - 327
Target Start/End: Complemental strand, 1869437 - 1869396
Alignment:
286 tcgcatgaaatttagtgtgcatactacaatttagaaatgtat 327  Q
    ||||||||||||||||||| |||||| |||||||||||||||    
1869437 tcgcatgaaatttagtgtggatactataatttagaaatgtat 1869396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University