View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0859_low_31 (Length: 319)
Name: NF0859_low_31
Description: NF0859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0859_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 8e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 49 - 222
Target Start/End: Original strand, 1038760 - 1038933
Alignment:
Q |
49 |
gaacaactttttattcagattaggttacaaaaattgattccgtactggaatttttctgtcaagtaaacgtacgtaatagagactgtggcagctgcgacaa |
148 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
1038760 |
gaacaactttttattcagattaggttacaaaaattgattccttactggaatttttctgtcaagtaaacgtacgtaatagagactgtggcagccgcgacaa |
1038859 |
T |
 |
Q |
149 |
attctaaaatcaaatgaaaagtgttaatcaaacaatagtgccacaagtaaagattaatagactgaatgtgttat |
222 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1038860 |
attctaaaatcaaatgaaaagtgttaatcaaacaatagtgccacaagtaaagattaatagactgaatgtgttat |
1038933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 57 - 185
Target Start/End: Complemental strand, 14155291 - 14155167
Alignment:
Q |
57 |
ttttattcagattaggttacaaaaattgattccgtactggaatttttctgtcaagtaaacgtacgtaatagagactgtggcagctgcgacaaattctaaa |
156 |
Q |
|
|
|||||||||||||| |||||||||||||||||| |||||||||||| ||||||| |||||| | || |||||||||||||| ||| ||||||||||| |
|
|
T |
14155291 |
ttttattcagattaagttacaaaaattgattccttactggaattttcctgtcaactaaacgca----atggagactgtggcagccgcggcaaattctaaa |
14155196 |
T |
 |
Q |
157 |
atcaaatgaaaagtgttaatcaaacaata |
185 |
Q |
|
|
|| |||||||||||||||||||||||||| |
|
|
T |
14155195 |
ataaaatgaaaagtgttaatcaaacaata |
14155167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 127 - 182
Target Start/End: Complemental strand, 14139596 - 14139541
Alignment:
Q |
127 |
gagactgtggcagctgcgacaaattctaaaatcaaatgaaaagtgttaatcaaaca |
182 |
Q |
|
|
||||||| |||||| ||| ||||||||||||||||||||||| ||||||||||| |
|
|
T |
14139596 |
gagactgcggcagccgcgccaaattctaaaatcaaatgaaaaacattaatcaaaca |
14139541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University