View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0859_low_34 (Length: 294)
Name: NF0859_low_34
Description: NF0859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0859_low_34 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 27 - 294
Target Start/End: Original strand, 31650638 - 31650904
Alignment:
Q |
27 |
cctagctgttgcacccatttgctttaaccttttctcttgttgcacactcaaggctgtatttgactgcaaattcaatacacataaatatttcaatacatta |
126 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31650638 |
cctaactgttgcacccatttgctttaaccttttctcttgttgcacactcaaggctgtatttgactgcaaattcaatacacataaatatttcaatacatta |
31650737 |
T |
 |
Q |
127 |
aaggatctatgtgaaatataattggatggaggtactaaaatcggtcggaaaatctagaggggacaaaatagaaaaactcttaactatagagaccaaaagt |
226 |
Q |
|
|
|||||| |||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||||||||||| |||||| |
|
|
T |
31650738 |
aaggatttatgtgaaatataa-tcgatggaggtactaaaatcggtcagaaaatctagaggggacaaaatagcaaaactc-taactatagagactaaaagt |
31650835 |
T |
 |
Q |
227 |
gtaattaagc-caaaaaagactatcgcattcatatgatgcagcacgtcatgaattaacttatgaataca |
294 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31650836 |
gtaattaagcaaaaaaaagactatcgcattcatatgatgcagcacgtcatgaattaacttatgaataca |
31650904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University