View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0859_low_41 (Length: 265)
Name: NF0859_low_41
Description: NF0859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0859_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 15935924 - 15936133
Alignment:
Q |
1 |
ttttcgtccacgacgttgccggagccggaagccatcctgtatctgtttgtgtttgtttagcaggcaggttaggttaggttacgtgatatttgagtatgag |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
T |
15935924 |
ttttcgtccacgacgttgccggagccggaagccatcctgtatctgtttgtgtttgtttagcaggcaggttaggttaagttacgtgatattttagtatgag |
15936023 |
T |
 |
Q |
101 |
tatttaaccctactgttttggatataacaaacnnnnnnnccctaattacgtgaagccgaacctaacacctcacccttaaaagcagccaatcaaatatttt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15936024 |
tatttaaccctactgttttggatataacaaacaaaaaaaccctaattacgtgaagccgaacctaacacctcacccttaaaagcagccaatcaaatatttt |
15936123 |
T |
 |
Q |
201 |
caataattaa |
210 |
Q |
|
|
|||||||||| |
|
|
T |
15936124 |
caataattaa |
15936133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University