View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0859_low_43 (Length: 253)
Name: NF0859_low_43
Description: NF0859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0859_low_43 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 14 - 253
Target Start/End: Original strand, 2488782 - 2489021
Alignment:
| Q |
14 |
agaatcaactgatcaaccatatcatttttataattactgcaattgcatcacataaattaaattaatgataaagatgacacttttttcagtaaagaagaca |
113 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2488782 |
agaatcaactgatcaaccatataatttttataattactgcaattgcatcacataaattaaattaatgataaagatgacactttttttagtaaagaagaca |
2488881 |
T |
 |
| Q |
114 |
caaaaatttaaaataaccattcttgacatgttaatttctttaaataaaaaattaatagaaaccacaacatgcacatatacgtagataaaagattcacatt |
213 |
Q |
| |
|
| |||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2488882 |
cgaaaatttaaaataagcattcttgacatgttaacttctttaaataaaaaattaatagaaaccacaacatgcacatatacgtagataaaagattcacatt |
2488981 |
T |
 |
| Q |
214 |
gcttttattttaatcttgacaaattggagactggttggtt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2488982 |
gcttttattttaatcttgacaaattggagactggttggtt |
2489021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University