View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0859_low_46 (Length: 251)
Name: NF0859_low_46
Description: NF0859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0859_low_46 |
 | |
|
| [»] scaffold0643 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0643 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: scaffold0643
Description:
Target: scaffold0643; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 11 - 209
Target Start/End: Original strand, 8039 - 8228
Alignment:
| Q |
11 |
cagagatggggaatttgatttttctggtggtttttgttatctctgtcatggactgtgttgtttgtgcagtttgtcctagttgctaaggtgctatgtggta |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| ||| ||||||| |
|
|
| T |
8039 |
cagagatggggaatttgatttttctggtggtttttgttatctctgtcgtggactgtgttgtttgtgcggtttgtcctagttgctaaggcgctctgtggta |
8138 |
T |
|
| Q |
111 |
ctgcttgttttcttttcttcacctgtggtgtccccttctttcgctgatacaaggaggggttgtttccttgtgtggctcgctagcttatctcctatagct |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
8139 |
ctgcttgttttcttttcttcacctgtggtgtccccttctttcgctgatacaaggaggggctgttt---------gctcgctagcttatctcctatagct |
8228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 11 - 244
Target Start/End: Complemental strand, 30014245 - 30014011
Alignment:
| Q |
11 |
cagagatggggaatttgatttttctggtggtttttgttatctctgtcatggactgtgttgtttgtgcagtttgtcctagttgctaaggtgctatgtggta |
110 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||||||||||| |||||||||||| ||| |||| | | |
|
|
| T |
30014245 |
cagagatggggaatttgatttttctagtggtttttgttatctctatcgtggactgtgttgtttgtgcggtttgtcctagtagct---gtgcggtttatct |
30014149 |
T |
|
| Q |
111 |
ctg-cttgttttc---ttttcttcacctgtggtgtccccttctttcgctgatacaaggaggggttgtttccttgtgtggctcgctagcttatctcctata |
206 |
Q |
| |
|
||| | || || ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30014148 |
ctgtcgtgaatttgatttttcttcacctgtggtgtccccttctttcgctgatacaaggaggggctgtttccttgtgtggcttgctagcttatctcctata |
30014049 |
T |
|
| Q |
207 |
gctactgtttgtggtgtttttgctgttacggcgtgctg |
244 |
Q |
| |
|
||| ||||||||||| ||||||||||||| |||||||| |
|
|
| T |
30014048 |
gctgctgtttgtggtatttttgctgttacagcgtgctg |
30014011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3458 times since January 2019
Visitors: 6174