View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0859_low_48 (Length: 246)
Name: NF0859_low_48
Description: NF0859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0859_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 9 - 229
Target Start/End: Complemental strand, 1869582 - 1869363
Alignment:
Q |
9 |
gacatcatcatcatttgtaaggtacataatgctctaaaagagtctcatttttcttttaaaaaacatatgcggattgataacggctatttatataggaata |
108 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
1869582 |
gacatcaccatcatttgtaaggtacataatgctctaaaagagtctcatttttcttttaaaaaacatatgcggattgataacggct-tttatataggaata |
1869484 |
T |
 |
Q |
109 |
tcggaaacactctctttcttaacactctctaacagtcactttcttatcgcatgaaatttagtgtggatactacaatttagaaatgtatttcatgtaaagt |
208 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || ||||||| |
|
|
T |
1869483 |
tcggaaacactctctttcttaacactctctaatagtcactttcttatcgcatgaaatttagtgtggatactataatttagaaatgtatcccacgtaaagt |
1869384 |
T |
 |
Q |
209 |
ggtgaaacccacataagtttc |
229 |
Q |
|
|
| ||| ||||||||||||||| |
|
|
T |
1869383 |
gatgagacccacataagtttc |
1869363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University