View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0859_low_50 (Length: 231)
Name: NF0859_low_50
Description: NF0859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0859_low_50 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 21 - 231
Target Start/End: Complemental strand, 27385694 - 27385484
Alignment:
| Q |
21 |
tagtcgagaatgctaggaataaaggaaagtcatacaacatccttgccaacaagcttacgacttttgatattcttataatagtccaactcatccagctcca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| ||||||||||| ||||||||| |
|
|
| T |
27385694 |
tagtcgagaatgctaggaataaaggaaagtcatacaacatccttgccaacaagcttaccacttttgatatttttataacagtccaactcacccagctcca |
27385595 |
T |
|
| Q |
121 |
agacgaccttagggttgaagtgcttgatctgactaacggtattcttgaaggagtctgaccctgtgtccctgaaggccttgcaccataccttctctcaacc |
220 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27385594 |
agacgacctcagggttgaagtgcttgatctgattaacgatattcttgaaggagtctgaccatgtgtccctgaaggccttgcaccataccttctctcaacc |
27385495 |
T |
|
| Q |
221 |
atccaataatc |
231 |
Q |
| |
|
||||||||||| |
|
|
| T |
27385494 |
atccaataatc |
27385484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2046 times since January 2019
Visitors: 6156