View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0859_low_51 (Length: 226)
Name: NF0859_low_51
Description: NF0859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0859_low_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 9 - 209
Target Start/End: Complemental strand, 1869562 - 1869363
Alignment:
| Q |
9 |
ggtagataatactctaaaagagtctcatttttcttttaaaaaacatatgcggattgataacggctatttatataggaatatcggaaacactctctttctt |
108 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1869562 |
ggtacataatgctctaaaagagtctcatttttcttttaaaaaacatatgcggattgataacggct-tttatataggaatatcggaaacactctctttctt |
1869464 |
T |
 |
| Q |
109 |
aacactctctaacagtcactttcttatcgcatgaaatttagtgtggatactacaatttagaaatgtatttcatgtaaagtggtgaaacccacataagttt |
208 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || |||||||| ||| |||||||||||||| |
|
|
| T |
1869463 |
aacactctctaatagtcactttcttatcgcatgaaatttagtgtggatactataatttagaaatgtatcccacgtaaagtgatgagacccacataagttt |
1869364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University