View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0859_low_52 (Length: 225)
Name: NF0859_low_52
Description: NF0859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0859_low_52 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 147 - 225
Target Start/End: Complemental strand, 2746028 - 2745950
Alignment:
| Q |
147 |
cagtgagtgctgctaagaggaagtaaaacctatccaaatgtcccatatttaagttccctggaatccaaccaagcatgcc |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2746028 |
cagtgagtgctgctaagaggaagtaaaacctatccaaatgtcccatatttaagttccctggaatccaaccaagcatgcc |
2745950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2958 times since January 2019
Visitors: 6168