View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0859_low_61 (Length: 211)

Name: NF0859_low_61
Description: NF0859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0859_low_61
NF0859_low_61
[»] chr6 (1 HSPs)
chr6 (31-166)||(2102486-2102620)


Alignment Details
Target: chr6 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 31 - 166
Target Start/End: Original strand, 2102486 - 2102620
Alignment:
31 cccttaatgtgtatgcactaacctaacttcatttattataactttatcacttaaattgtatctgaatgaattgaataatgataacattaaaagataatcc 130  Q
    |||||| |||||||||| ||||||| |||||| ||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
2102486 cccttactgtgtatgcattaacctatcttcatgtattataactt-atcacttaaattgcatctgaatgaattgaataatgataacattaaaagataatcc 2102584  T
131 gaatttaccatcatatttttattgggtttgcaacag 166  Q
    ||||||||||||||||||||||||||||||||||||    
2102585 gaatttaccatcatatttttattgggtttgcaacag 2102620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1318 times since January 2019
Visitors: 6140