View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0860_high_10 (Length: 267)
Name: NF0860_high_10
Description: NF0860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0860_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 27 - 245
Target Start/End: Complemental strand, 3907988 - 3907770
Alignment:
| Q |
27 |
cattgtatccgagacttcctgctgtagcaatgatgttggtgttggcagaagttgtcattagtcttgaaagaccaaaatctatgatgtgagggtttgtttg |
126 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
3907988 |
cattgtatccaagacttcctgctgtagcaatgatgttggtgttggcagaagttgtcattagtcttgaaagaccaaaatctgtgatgtgaggatttgtttg |
3907889 |
T |
|
| Q |
127 |
ctcatccaatagtatgttacttgaggtgagatttccctgtactatattctcttgattgtggtggcaagagagaccatttgtgattccaattgctattttc |
226 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || || |||||||||||||| ||||| |||| | |||||||| ||||||||||| ||||||||| |
|
|
| T |
3907888 |
ctcatccaatagtatgttgcttgaggtgagattcccatgaactatattctcttggttgtgtaagcaaaatagaccattagtgattccaatagctattttc |
3907789 |
T |
|
| Q |
227 |
atccttgttggccattcga |
245 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
3907788 |
atccttgttggccattcga |
3907770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 806 times since January 2019
Visitors: 6131