View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0860_high_13 (Length: 242)
Name: NF0860_high_13
Description: NF0860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0860_high_13 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 21 - 242
Target Start/End: Complemental strand, 36152304 - 36152083
Alignment:
Q |
21 |
cctacatcacctaacactcacctcttggaagagattttttcttgtaggaagatggtgcataaccaattgctaagaaaaggttaacttttttgatggagca |
120 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
36152304 |
cctacatcacctaacactcacctcttggaagagattttttcttgtaggaagatggtgcataaccaattgctaagaaaaggttaacatttttgatggagca |
36152205 |
T |
 |
Q |
121 |
taacttccccatacctttgctatatccgaattttgtgactcatgaaaggaagacagagggaataccttgttgctaagataaagataaaaggagatcacgg |
220 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36152204 |
taacttccccatacctttgctatatccgaattttgtgactcatgaaaggaagacagagggaataccttgttgctaagataaagataaaaggagatcacgg |
36152105 |
T |
 |
Q |
221 |
agaaggtaccttgaaaatcatt |
242 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
36152104 |
agaaggtaccttgaaaatcatt |
36152083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1524 times since January 2019
Visitors: 6144