View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0860_low_11 (Length: 289)
Name: NF0860_low_11
Description: NF0860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0860_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 65 - 229
Target Start/End: Original strand, 7530852 - 7531016
Alignment:
| Q |
65 |
tgggaactcttgtcaaagaagattttggtcggccggatagagccaacacaatggtgaaaattttggctcttcctatatgttgttgatttgctatttggta |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7530852 |
tgggaactcttgtcaaagaagattttggtcggccggatagagccaacacaatggtgaaaattttggctcttcctatatgttgttgatttgctatttggta |
7530951 |
T |
 |
| Q |
165 |
gtttataacaagtgttgttttgcagggcatgaggcatggttcttatgataaattggatgatgatg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7530952 |
gtttataacaagtgttgttttgcagggcatgaggcatggttcttatgataaattggatgatgatg |
7531016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University