View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0860_low_11 (Length: 289)

Name: NF0860_low_11
Description: NF0860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0860_low_11
NF0860_low_11
[»] chr1 (1 HSPs)
chr1 (65-229)||(7530852-7531016)


Alignment Details
Target: chr1 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 65 - 229
Target Start/End: Original strand, 7530852 - 7531016
Alignment:
65 tgggaactcttgtcaaagaagattttggtcggccggatagagccaacacaatggtgaaaattttggctcttcctatatgttgttgatttgctatttggta 164  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7530852 tgggaactcttgtcaaagaagattttggtcggccggatagagccaacacaatggtgaaaattttggctcttcctatatgttgttgatttgctatttggta 7530951  T
165 gtttataacaagtgttgttttgcagggcatgaggcatggttcttatgataaattggatgatgatg 229  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7530952 gtttataacaagtgttgttttgcagggcatgaggcatggttcttatgataaattggatgatgatg 7531016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 618 times since January 2019
Visitors: 6130