View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0860_low_14 (Length: 273)
Name: NF0860_low_14
Description: NF0860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0860_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 52 - 190
Target Start/End: Complemental strand, 43191374 - 43191234
Alignment:
| Q |
52 |
gttatgttatgggtgttaaaagagcttggtagaattcaattcaatactactcctcaacaaaatttccaagttgaatgaagtctagaacatggtcaaattt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43191374 |
gttatgttatgggtgttaaaagagcttggtagaattcaattcaatactactcctcaacaaaatttccaagttgaatgaagtctagaacatggtcaaattt |
43191275 |
T |
|
| Q |
152 |
ttattgtttatat-cccacaagg-aaacggattcagagtat |
190 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
43191274 |
ttattgtttatatccccacaaggaaaacggattcagagtat |
43191234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 715 times since January 2019
Visitors: 6130