View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0860_low_15 (Length: 272)
Name: NF0860_low_15
Description: NF0860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0860_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 46 - 243
Target Start/End: Complemental strand, 49518225 - 49518042
Alignment:
| Q |
46 |
tcatcaataataacattctccttccccattttgtccttccnnnnnnnaaattttagattatatcccttgagaccagtttctatccccttgtcatcagcaa |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
49518225 |
tcatcaataataacattctccttccccattttgtccttcctttttttaaattttagattatatcccttgagaccagtttctatccccttgtcatcaggaa |
49518126 |
T |
 |
| Q |
146 |
gcaatagttcaagctcttctttgcttgctttgtcaacagcaaccatatccatgtgttggaggttattatgatctttgtcatttttactcatctgtgct |
243 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49518125 |
gcaatagttcaa--------------gctttgtcaacagcaaccatatccatgtgttggaggttattatgatctttgtcatttttactcatttgtgct |
49518042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 46 - 197
Target Start/End: Complemental strand, 27747596 - 27747445
Alignment:
| Q |
46 |
tcatcaataataacattctccttccccattttgtccttccnnnnnnnaaattttagattatatcccttgagaccagtttctatccccttgtcatcagcaa |
145 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||||| ||||||| ||||||||||||||| || ||||||||||||||| |
|
|
| T |
27747596 |
tcatcaataataacattctcctttcccattttgtccttcctttttttaaattttagactatatcctttgagaccagtttctgtcgccttgtcatcagcaa |
27747497 |
T |
 |
| Q |
146 |
gcaatagttcaagctcttctttgcttgctttgtcaacagcaaccatatccat |
197 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27747496 |
gcaataactcaagctcttctttgcttgctttgtcaacagcaactatatccat |
27747445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 100 - 177
Target Start/End: Original strand, 38527375 - 38527452
Alignment:
| Q |
100 |
agattatatcccttgagaccagtttctatccccttgtcatcagcaagcaatagttcaagctcttctttgcttgctttg |
177 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38527375 |
agattatatcccttgagaccagtacctgtccccttgtcatcagcaagcaacagttcaagctcttctttgcttgctttg |
38527452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University