View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0860_low_21 (Length: 229)
Name: NF0860_low_21
Description: NF0860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0860_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 128 - 216
Target Start/End: Complemental strand, 51767132 - 51767044
Alignment:
| Q |
128 |
agaaaagttgaaaccgataagaacnnnnnnncaagagccccatataaaaacttaaaagagaaaagaccggatttgttaagagtccgagt |
216 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51767132 |
agaaaagttgaaaccgataataactttttttcaagagccccatataaaaacttaaaagagaaaagaccggatttgtcaagagtccgagt |
51767044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1153 times since January 2019
Visitors: 6137