View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0860_low_8 (Length: 333)
Name: NF0860_low_8
Description: NF0860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0860_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 95 - 302
Target Start/End: Complemental strand, 4885410 - 4885203
Alignment:
Q |
95 |
atgttgcatatcttgcattctaccatgtggagcacttgatgtgatccgtatagtacactgcaacggtcgagtagaagaaatcagtggcagcatcaaagca |
194 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4885410 |
atgttgcatatcttgcattctaccatgtggagcacttgatgtgatccgtatagtacactgcaacggtcgagtagaagaaatcagtggcagcatcaaagca |
4885311 |
T |
 |
Q |
195 |
agtgaaatcatgaaaacatacccaaaacatgttctcaagaaaccttcttcaccttcaacacaagatggcggagttgttcctaagatcgttgttgtccctc |
294 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
4885310 |
agtgaaatcatgaaaacatacccaaaacatgttctcaagaaaccttcttcaccttcaacacaagatggcggtgttgttcctaagatcgttgttgtccctc |
4885211 |
T |
 |
Q |
295 |
cctatgct |
302 |
Q |
|
|
|| ||||| |
|
|
T |
4885210 |
ccgatgct |
4885203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University