View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0861_low_11 (Length: 202)

Name: NF0861_low_11
Description: NF0861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0861_low_11
NF0861_low_11
[»] chr5 (1 HSPs)
chr5 (1-46)||(38299378-38299423)


Alignment Details
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 38299423 - 38299378
Alignment:
1 tagggtgatgtaaatgagaatctggctagggttttgatggaaagag 46  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
38299423 tagggtgatgtaaatgagaatctggctagggttttgatggaaagag 38299378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2780 times since January 2019
Visitors: 6167