View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0861_low_8 (Length: 251)
Name: NF0861_low_8
Description: NF0861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0861_low_8 |
 |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 164
Target Start/End: Complemental strand, 52044796 - 52044627
Alignment:
| Q |
1 |
gatagtgttcttgtgtttcaactttttcaatggaactgccaaatgg-atcatttgtttccagaaaacactgaatctcat-----gtcttgtgtttgtcca |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52044796 |
gatagtgttgttgtgtttcaactttttcaatggaactgccaaatgggatcatttgtttccagaaaacactgaatctcatctcatgtcttgtgtttgtcca |
52044697 |
T |
 |
| Q |
95 |
tgcatcctttctcttttttggtgggtcccaaatccattttctagaactcactacaattctgctatcaata |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52044696 |
tgcatcctttctcttttttggtgggtcccaaatccattttctagaactcactacaattctgctatcaata |
52044627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 236
Target Start/End: Complemental strand, 27533322 - 27533267
Alignment:
| Q |
181 |
tcttttgggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
|||||| ||||||| |||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
27533322 |
tctttttggtggtggtcggggtttgaaccccgaaccttgcatatattatgcattgt |
27533267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 47417860 - 47417807
Alignment:
| Q |
183 |
ttttgggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
|||| ||||||||||| ||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
47417860 |
tttttggtggtgaccgaggtttgaactccgaaccttgcatatattatgcattgt |
47417807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 200 - 237
Target Start/End: Original strand, 49798308 - 49798345
Alignment:
| Q |
200 |
ggtttcaaccccgaatattgcatatattatgcattgtt |
237 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
49798308 |
ggtttgaaccccgaacattgcatatattatgcattgtt |
49798345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 8)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 188 - 238
Target Start/End: Complemental strand, 6471583 - 6471533
Alignment:
| Q |
188 |
ggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgttc |
238 |
Q |
| |
|
||||||| ||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
6471583 |
ggtggtggccggggtttgaaccccgaacattgcatatattatgcattgttc |
6471533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 183 - 232
Target Start/End: Original strand, 32286348 - 32286397
Alignment:
| Q |
183 |
ttttgggtggtgaccggggtttcaaccccgaatattgcatatattatgca |
232 |
Q |
| |
|
|||| ||||||| ||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
32286348 |
tttttggtggtggccggggtttgaaccccgaatcttgcatatattatgca |
32286397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 238
Target Start/End: Original strand, 29924900 - 29924956
Alignment:
| Q |
182 |
cttttgggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgttc |
238 |
Q |
| |
|
||||| ||||||| | ||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
29924900 |
ctttttggtggtgtctggggtttaaaccccgaaccttgcatatattatgcattgttc |
29924956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 23159504 - 23159465
Alignment:
| Q |
197 |
cggggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
23159504 |
cggggtttgaaccccgaatcttgcatatattatgcattgt |
23159465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 10601840 - 10601787
Alignment:
| Q |
183 |
ttttgggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
|||| ||| ||| ||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
10601840 |
tttttggttgtggccggggtttgaatcccgaatcttgcatatattatgcattgt |
10601787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 12748978 - 12748925
Alignment:
| Q |
183 |
ttttgggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
|||| ||||||| ||||||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
12748978 |
tttttggtggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
12748925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 198 - 238
Target Start/End: Complemental strand, 18533731 - 18533691
Alignment:
| Q |
198 |
ggggtttcaaccccgaatattgcatatattatgcattgttc |
238 |
Q |
| |
|
||||||| ||||||| || |||||||||||||||||||||| |
|
|
| T |
18533731 |
ggggtttgaaccccggatcttgcatatattatgcattgttc |
18533691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 236
Target Start/End: Original strand, 32051521 - 32051569
Alignment:
| Q |
188 |
ggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
||||||| ||||||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
32051521 |
ggtggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
32051569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 192 - 240
Target Start/End: Complemental strand, 28568273 - 28568225
Alignment:
| Q |
192 |
gtgaccggggtttcaaccccgaatattgcatatattatgcattgttcat |
240 |
Q |
| |
|
||||||||||||| |||||||||| ||| |||||||||||||||||||| |
|
|
| T |
28568273 |
gtgaccggggtttgaaccccgaatcttgtatatattatgcattgttcat |
28568225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 20799378 - 20799431
Alignment:
| Q |
183 |
ttttgggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
|||| |||||||||| |||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
20799378 |
tttttggtggtgaccagggtttgaaccccggaccttgcatatattatgcattgt |
20799431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 28435232 - 28435285
Alignment:
| Q |
183 |
ttttgggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
|||| ||||||| | ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
28435232 |
tttttggtggtggctggggtttgaaccccgaaccttgcatatattatgcattgt |
28435285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 240
Target Start/End: Original strand, 24675066 - 24675110
Alignment:
| Q |
196 |
ccggggtttcaaccccgaatattgcatatattatgcattgttcat |
240 |
Q |
| |
|
||||| ||| |||||| ||| |||||||||||||||||||||||| |
|
|
| T |
24675066 |
ccgggatttgaaccccaaatcttgcatatattatgcattgttcat |
24675110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 9)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 190 - 240
Target Start/End: Original strand, 28965768 - 28965818
Alignment:
| Q |
190 |
tggtgaccggggtttcaaccccgaatattgcatatattatgcattgttcat |
240 |
Q |
| |
|
||||||||||||||| ||||||||| || ||||||||||||||||||||| |
|
|
| T |
28965768 |
tggtgaccggggtttgaaccccgaaccttacatatattatgcattgttcat |
28965818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 11358311 - 11358258
Alignment:
| Q |
183 |
ttttgggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
|||||||||||| ||||||||| ||||||| || |||||||||||||| ||||| |
|
|
| T |
11358311 |
ttttgggtggtggccggggtttgaaccccggatcttgcatatattatgaattgt |
11358258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 177 - 236
Target Start/End: Original strand, 48849741 - 48849800
Alignment:
| Q |
177 |
gtattcttttgggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
|||||||||| |||||| ||||||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
48849741 |
gtattcttttttgtggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
48849800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 196 - 238
Target Start/End: Original strand, 54020646 - 54020688
Alignment:
| Q |
196 |
ccggggtttcaaccccgaatattgcatatattatgcattgttc |
238 |
Q |
| |
|
||||||| | ||||||||||||| ||||||||||||||||||| |
|
|
| T |
54020646 |
ccggggtctgaaccccgaatattacatatattatgcattgttc |
54020688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 16792958 - 16793011
Alignment:
| Q |
183 |
ttttgggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
|||| ||||||||||||||||| ||||| | | |||||||||||||||||||| |
|
|
| T |
16792958 |
tttttggtggtgaccggggtttgaaccctggaccttgcatatattatgcattgt |
16793011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 22843541 - 22843488
Alignment:
| Q |
183 |
ttttgggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
||||| |||||| | ||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
22843541 |
ttttgtgtggtgtctggggtttcaaccccgaaccttacatatattatgcattgt |
22843488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 29631263 - 29631210
Alignment:
| Q |
183 |
ttttgggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
|||| ||||||| ||||||||| || |||||| |||||||||||||||||||| |
|
|
| T |
29631263 |
tttttggtggtggccggggtttgaatcccgaaccttgcatatattatgcattgt |
29631210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 38130943 - 38130996
Alignment:
| Q |
183 |
ttttgggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
|||| ||||||| ||||||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
38130943 |
tttttggtggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
38130996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 239
Target Start/End: Original strand, 20612261 - 20612317
Alignment:
| Q |
183 |
ttttgggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgttca |
239 |
Q |
| |
|
|||| ||| ||| ||||||||| |||||| || ||||||||||||||||||||||| |
|
|
| T |
20612261 |
tttttggtagtggccggggtttgaaccccaaaccttgcatatattatgcattgttca |
20612317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 189 - 236
Target Start/End: Original strand, 41630102 - 41630149
Alignment:
| Q |
189 |
gtggtgaccggggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
|||||||||||||||| || |||||| |||||||||||||||||||| |
|
|
| T |
41630102 |
gtggtgaccggggtttgaatcccgaaccttgcatatattatgcattgt |
41630149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 19248556 - 19248503
Alignment:
| Q |
183 |
ttttgggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
|||| |||||||||| || ||| |||||| || ||||||||||||||||||||| |
|
|
| T |
19248556 |
tttttggtggtgaccaggatttgaaccccaaacattgcatatattatgcattgt |
19248503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 22522785 - 22522838
Alignment:
| Q |
183 |
ttttgggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
|||| ||||||| ||||||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
22522785 |
tttttggtggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
22522838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 200 - 236
Target Start/End: Complemental strand, 31280079 - 31280043
Alignment:
| Q |
200 |
ggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
31280079 |
ggtttgaaccccggatattgcatatattatgcattgt |
31280043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 190 - 236
Target Start/End: Complemental strand, 185333 - 185287
Alignment:
| Q |
190 |
tggtgaccggggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
||||||||||||||| ||||||| || |||||||| ||||||||||| |
|
|
| T |
185333 |
tggtgaccggggtttgaaccccggatcttgcatattttatgcattgt |
185287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 14046601 - 14046646
Alignment:
| Q |
189 |
gtggtgaccggggtttcaaccccgaatattgcatatattatgcatt |
234 |
Q |
| |
|
|||||| ||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
14046601 |
gtggtggccggggtttgaaccccgtatcttgcatatattatgcatt |
14046646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 14356631 - 14356676
Alignment:
| Q |
189 |
gtggtgaccggggtttcaaccccgaatattgcatatattatgcatt |
234 |
Q |
| |
|
|||||| ||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
14356631 |
gtggtggccggggtttgaaccccgtatcttgcatatattatgcatt |
14356676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 46987163 - 46987110
Alignment:
| Q |
183 |
ttttgggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
|||||||||||| |||||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
46987163 |
ttttgggtggtgtccggggttcgaaccccggaccttgcatatattatgcattgt |
46987110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 200 - 236
Target Start/End: Original strand, 39926539 - 39926575
Alignment:
| Q |
200 |
ggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
39926539 |
ggtttgaaccccgaacattgcatatattatgcattgt |
39926575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 198 - 238
Target Start/End: Original strand, 47677576 - 47677616
Alignment:
| Q |
198 |
ggggtttcaaccccgaatattgcatatattatgcattgttc |
238 |
Q |
| |
|
||||||| ||||||||| ||||||||| ||||||||||||| |
|
|
| T |
47677576 |
ggggtttgaaccccgaacattgcatattttatgcattgttc |
47677616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 29544704 - 29544651
Alignment:
| Q |
183 |
ttttgggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgt |
236 |
Q |
| |
|
|||| ||||||| ||||||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
29544704 |
tttttggtggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
29544651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 240
Target Start/End: Original strand, 40295455 - 40295499
Alignment:
| Q |
196 |
ccggggtttcaaccccgaatattgcatatattatgcattgttcat |
240 |
Q |
| |
|
||||||||| |||| ||||| ||||||| |||||||||||||||| |
|
|
| T |
40295455 |
ccggggtttgaacctcgaatcttgcatacattatgcattgttcat |
40295499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 240
Target Start/End: Complemental strand, 2445371 - 2445319
Alignment:
| Q |
188 |
ggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgttcat |
240 |
Q |
| |
|
||||||| ||||||| |||||||||| ||| |||||||||||||||||||| |
|
|
| T |
2445371 |
ggtggtggtcggggttcgaaccccgaatcttgtatatattatgcattgttcat |
2445319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 240
Target Start/End: Complemental strand, 26548323 - 26548271
Alignment:
| Q |
188 |
ggtggtgaccggggtttcaaccccgaatattgcatatattatgcattgttcat |
240 |
Q |
| |
|
||||||| | ||||||| ||||||||| ||||||||||||| |||||||||| |
|
|
| T |
26548323 |
ggtggtggctggggtttgaaccccgaaccttgcatatattatacattgttcat |
26548271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University