View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0861_low_9 (Length: 247)
Name: NF0861_low_9
Description: NF0861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0861_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 70 - 138
Target Start/End: Complemental strand, 42114911 - 42114843
Alignment:
Q |
70 |
ttctatatttgctgttggtgctgttatggcttttgaatctcgcctcgcaaataccagcctcaagtataa |
138 |
Q |
|
|
||||||||||||| ||||||||||||||||||||| |||| | || ||||| ||||||||||||||||| |
|
|
T |
42114911 |
ttctatatttgctcttggtgctgttatggcttttgcatctggtcttgcaaacaccagcctcaagtataa |
42114843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 9 - 57
Target Start/End: Complemental strand, 42115573 - 42115525
Alignment:
Q |
9 |
tttctgtgttttcaaattttagatgatatttgttatgctaagaataagg |
57 |
Q |
|
|
||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
42115573 |
tttctgtttttccaaattttagatgatatttgttatgctaagaataagg |
42115525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University