View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0861_low_9 (Length: 247)

Name: NF0861_low_9
Description: NF0861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0861_low_9
NF0861_low_9
[»] chr5 (2 HSPs)
chr5 (70-138)||(42114843-42114911)
chr5 (9-57)||(42115525-42115573)


Alignment Details
Target: chr5 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 70 - 138
Target Start/End: Complemental strand, 42114911 - 42114843
Alignment:
70 ttctatatttgctgttggtgctgttatggcttttgaatctcgcctcgcaaataccagcctcaagtataa 138  Q
    ||||||||||||| ||||||||||||||||||||| |||| | || ||||| |||||||||||||||||    
42114911 ttctatatttgctcttggtgctgttatggcttttgcatctggtcttgcaaacaccagcctcaagtataa 42114843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 9 - 57
Target Start/End: Complemental strand, 42115573 - 42115525
Alignment:
9 tttctgtgttttcaaattttagatgatatttgttatgctaagaataagg 57  Q
    ||||||| ||| |||||||||||||||||||||||||||||||||||||    
42115573 tttctgtttttccaaattttagatgatatttgttatgctaagaataagg 42115525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University