View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0862_high_9 (Length: 203)
Name: NF0862_high_9
Description: NF0862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0862_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 24 - 195
Target Start/End: Complemental strand, 50308048 - 50307877
Alignment:
Q |
24 |
cttttgatcttctactttttctttcgcctcgataacttctccttcatttgttgaatcattcatttcttttttatcactctcattaatgttgccttcttct |
123 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
50308048 |
cttttgatcttctactttttctttcgcctcgataacttctccttcatttgttgaatcattcatttcttttttatcactctcattaatgttcccttcttct |
50307949 |
T |
 |
Q |
124 |
tggtttgtatccgtattttcattttggtcttgattatcttcatgttcatctttgttttgatcttcctttgct |
195 |
Q |
|
|
||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
50307948 |
tggtttgtatccgtattctcattttgatcttgattatcttcatgttcatctttgttttgatcttcttttgct |
50307877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University