View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0862_high_9 (Length: 203)

Name: NF0862_high_9
Description: NF0862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0862_high_9
NF0862_high_9
[»] chr3 (1 HSPs)
chr3 (24-195)||(50307877-50308048)


Alignment Details
Target: chr3 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 24 - 195
Target Start/End: Complemental strand, 50308048 - 50307877
Alignment:
24 cttttgatcttctactttttctttcgcctcgataacttctccttcatttgttgaatcattcatttcttttttatcactctcattaatgttgccttcttct 123  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
50308048 cttttgatcttctactttttctttcgcctcgataacttctccttcatttgttgaatcattcatttcttttttatcactctcattaatgttcccttcttct 50307949  T
124 tggtttgtatccgtattttcattttggtcttgattatcttcatgttcatctttgttttgatcttcctttgct 195  Q
    ||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||    
50307948 tggtttgtatccgtattctcattttgatcttgattatcttcatgttcatctttgttttgatcttcttttgct 50307877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University