View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0862_low_13 (Length: 272)

Name: NF0862_low_13
Description: NF0862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0862_low_13
NF0862_low_13
[»] chr5 (1 HSPs)
chr5 (54-236)||(29499495-29499677)


Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 54 - 236
Target Start/End: Original strand, 29499495 - 29499677
Alignment:
54 ggattaattcttaaaacaaagtaacaaataactaaggaatcaacatataaaaatgccaattaaggtaaaaagtaactactacggaccgtgacttgtaatc 153  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
29499495 ggattaattcttaaaacaaagtaacaaataactaaggaatcaacatataaaaatgccaattaaggtaaaaagtaactactccggaccgtgacttgtaatc 29499594  T
154 acatgaactccatcccttttattgttatccctaccaataaacaaaaaccttgaaatatgcatgtagtttaaaggaatgatatt 236  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
29499595 acatgaactccatcccttttattgttatccctaccaataaacaaaaaccttgaaatatgcatgtagtttagaggaatgatatt 29499677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University