View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0862_low_13 (Length: 272)
Name: NF0862_low_13
Description: NF0862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0862_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 54 - 236
Target Start/End: Original strand, 29499495 - 29499677
Alignment:
Q |
54 |
ggattaattcttaaaacaaagtaacaaataactaaggaatcaacatataaaaatgccaattaaggtaaaaagtaactactacggaccgtgacttgtaatc |
153 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
29499495 |
ggattaattcttaaaacaaagtaacaaataactaaggaatcaacatataaaaatgccaattaaggtaaaaagtaactactccggaccgtgacttgtaatc |
29499594 |
T |
 |
Q |
154 |
acatgaactccatcccttttattgttatccctaccaataaacaaaaaccttgaaatatgcatgtagtttaaaggaatgatatt |
236 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
29499595 |
acatgaactccatcccttttattgttatccctaccaataaacaaaaaccttgaaatatgcatgtagtttagaggaatgatatt |
29499677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University