View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0863_low_4 (Length: 344)
Name: NF0863_low_4
Description: NF0863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0863_low_4 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 104 - 344
Target Start/End: Original strand, 7806315 - 7806556
Alignment:
Q |
104 |
acaaaaattaatcttaattcaataattttcttcttcaatttatattcgtttataattttagtttagttgtatgtaatacttagttcaattgataaatatt |
203 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7806315 |
acaaaaattaatcttaattcaataattttcttcttcaatttatattcgtttataattttagtttagttgtatgtaatacttagttcaattgataaatatt |
7806414 |
T |
 |
Q |
204 |
gattttgttagattaaaaacttttacctgagtttgaaccggtattttgcccttatttgactgaggctgatatccaactagttggaaaatttgtcattttg |
303 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7806415 |
gattttgttagattaaaaacttttacctgagtttgaaccggtattttgcccttattcgactgaggctgatatccaactagttggaaaatttgtcattttg |
7806514 |
T |
 |
Q |
304 |
ttaa-tgcgattggaatccaggttatcttatcttattttaat |
344 |
Q |
|
|
|||| ||| ||||||||||| ||||||||||||||| ||||| |
|
|
T |
7806515 |
ttaattgcaattggaatccaagttatcttatcttatcttaat |
7806556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University