View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0863_low_5 (Length: 282)
Name: NF0863_low_5
Description: NF0863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0863_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 46 - 225
Target Start/End: Original strand, 9039330 - 9039509
Alignment:
| Q |
46 |
agggaaatatcatgtgtgatgtcaatgactgttagtaccttttgattacttttttaagctaagtagtattaataagtggataaggtgattggaatgattt |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9039330 |
agggaaatatcatgtgtgatgtcaatgactgttagtaccttttgattacttttttaagctaagtagtattaataagtggataaggtgattggaatgattt |
9039429 |
T |
 |
| Q |
146 |
tgttgaccaatttgatttggtaggtgaaactatttgtttggatataatgtgatgctgttgaaattactcttatttatgat |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9039430 |
tgttgaccaatttgatttggtaggtgaaactatttgtttggatataatgtgatgttgttgaaattactcttatttatgat |
9039509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University