View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0864_high_10 (Length: 340)
Name: NF0864_high_10
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0864_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 29 - 253
Target Start/End: Complemental strand, 43702807 - 43702583
Alignment:
Q |
29 |
cctgttatggatgcggactttgaaccgggtttagcgtggatggttatagcgacggatgaaggaggcatgcagcgaatacaagacggaatattgttaggtt |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43702807 |
cctgttatggatgcggactttgaaccgggtttagcgtggatggttatagcgacggatgaaggaggcatgcagcgaatacaagacggaatattgttaggtt |
43702708 |
T |
 |
Q |
129 |
tttccgaaggaaccgtttcctttggttctgcctttgcttttcccttcttcgccggcgccattttttcaattttccgacaatcgatgccggagacttgcgt |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
43702707 |
tttccgaaggaaccgtttcctttggttctgcctttgcttttcccttcttcgccggcgccattttttcaattttccgacgatcgatgccggagacttgcgt |
43702608 |
T |
 |
Q |
229 |
acttcaaacgctgtcgttttcgatc |
253 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
43702607 |
acttcaaacgctgtcgttttcgatc |
43702583 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 278 - 312
Target Start/End: Complemental strand, 43702578 - 43702544
Alignment:
Q |
278 |
gctttttgcattgtgttatgcgggggtatggaatt |
312 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
43702578 |
gctttttgcattgtgttatgcgggggtatggaatt |
43702544 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University