View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0864_high_12 (Length: 332)
Name: NF0864_high_12
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0864_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 269
Target Start/End: Complemental strand, 23220355 - 23220105
Alignment:
| Q |
13 |
tgaaacgacgtagtatttaggagtaataaggaaggaaacggcgtggtagaagcatggttggagcaacgaaatgaaaatgggtgcagcatttttgtttatt |
112 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23220355 |
tgaaacgacgtagtattgaggagtaataaggaaggaaacggtgtggtagaagcatggttggagcaacgaaatgaaaatgggtgcaacatttttgtttatt |
23220256 |
T |
|
| Q |
113 |
tctttgaggttgaaatttggagtgtggtcgttataaccaatggttcattcaaatgcagcattttgaaattaagtataaattattgaaattaagttatgct |
212 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
23220255 |
tctttgaggttgaaatttggagtgtgggcgttataaccaatggttcatccaaatgcagcattttgaaaat-----taaattattgaaattaagttatgct |
23220161 |
T |
|
| Q |
213 |
cctagattttaccatccaactaactaaagttcgctgtgccatccaaactgtgcattt |
269 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23220160 |
cctagattttaccatccaactaact-aagttcgctgtgccatccaaactgtgcattt |
23220105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 55 - 105
Target Start/End: Complemental strand, 23171855 - 23171805
Alignment:
| Q |
55 |
gtggtagaagcatggttggagcaacgaaatgaaaatgggtgcagcattttt |
105 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||| | |||| ||||||| |
|
|
| T |
23171855 |
gtggtagaagcagggttggagcaaggaaatgaaaatagatgcaacattttt |
23171805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1430 times since January 2019
Visitors: 6143