View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0864_high_21 (Length: 281)
Name: NF0864_high_21
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0864_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 74 - 246
Target Start/End: Original strand, 43553893 - 43554065
Alignment:
| Q |
74 |
agaactcccatcaatttctcaccttatggcgaccgcctgaaactgcaagatgtaagacactgttgccatatctatcttggcagtgcaataggtttgtacc |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43553893 |
agaactcccatcaatttctcaccttatggcgaccgcctgaaactgcaagatgtaagacactgttgccatatctatcttggcagtgcaataggtttgtacc |
43553992 |
T |
 |
| Q |
174 |
attggaaacttgcaccaagaaaaccaaagcatcatagcatccatatctcacggctaaatgaaataccgtctct |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43553993 |
attggaaacttgcaccaagaaaaccaaagcatcatagcatccatatctcacggctaaatgaaataccgtctct |
43554065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 72 - 246
Target Start/End: Original strand, 43549890 - 43550064
Alignment:
| Q |
72 |
tcagaactcccatcaatttctcaccttatggcgaccgcctgaaactgcaagatgtaagacactgttgccatatctatcttggcagtgcaataggtttgta |
171 |
Q |
| |
|
||||| ||| ||| || ||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||||| | ||||| ||| |||||| |
|
|
| T |
43549890 |
tcagagctcacataaacttctcaccttatggcgaccgcctgaaactgcgagatgtaagacagtgttgccatatttatcttgtctgtgcactagatttgta |
43549989 |
T |
 |
| Q |
172 |
ccattggaaacttgcaccaagaaaaccaaagcatcatagcatccatatctcacggctaaatgaaataccgtctct |
246 |
Q |
| |
|
|||| || |||| |||||||||||| ||||| ||||| |||||||||||||| |||| ||||| ||| |||||| |
|
|
| T |
43549990 |
ccataggcaactctcaccaagaaaactaaagcgtcataacatccatatctcacagctagatgaagtactgtctct |
43550064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University