View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0864_high_23 (Length: 270)

Name: NF0864_high_23
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0864_high_23
NF0864_high_23
[»] chr7 (1 HSPs)
chr7 (1-172)||(37816821-37816992)


Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 172
Target Start/End: Complemental strand, 37816992 - 37816821
Alignment:
1 tatgacaatacttcgaaaaagannnnnnnaacaaatacttcgaataggattatcaccaatgttgagagtttatgtaaaatatattaaaattgataatgta 100  Q
    ||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37816992 tatgacaatacttcgaaaaagatttttttaacaaatacttcgaataggattatcaccaatgttgagagtttatgtaaaatatattaaaattgataatgta 37816893  T
101 attaatgtgtatattttgtacgaggatctgagtttaaattctgatgaaagtgaaaatgttaatataaatgag 172  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
37816892 attaatgtgtatattttgtacgaggatctgagttcaaattctgatgaaagtgaaaatgttaatataaatgag 37816821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University