View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0864_high_28 (Length: 251)
Name: NF0864_high_28
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0864_high_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 36847493 - 36847737
Alignment:
| Q |
1 |
ttacactaaaaatagtcgttttacaccatatttgaataattccaagtatacattagctggggttggacatgatcttgataagatggttcttataattggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36847493 |
ttacactaaaaatagtcgttttacaccatatttgaataattccaagtatacattagctggggttggtcatgatcttgataagatggttcttataattggt |
36847592 |
T |
|
| Q |
101 |
accaacacagcttctggagatttttcttctgctacttatttgcttcatggtgcttcaaagggacgtcattggctactgatgacgactgctttcttaagtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36847593 |
accaacacagcttctggagatttttcttctgctacttatttgcttcatggtgcttcaaagggacgtcattggctactgatgacgactgctttcttgagtt |
36847692 |
T |
|
| Q |
201 |
tgtttgnnnnnnngttcaattaaactgaatgttattctctgctcc |
245 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
36847693 |
tgtttgtttttttgttcaattaaactgaatgttattttctgctcc |
36847737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 5 - 145
Target Start/End: Original strand, 36836037 - 36836177
Alignment:
| Q |
5 |
actaaaaatagtcgttttacaccatatttgaataattccaagtatacattagctggggttggacatgatcttgataagatggttcttataattggtacca |
104 |
Q |
| |
|
||||||||||||| |||||| ||||| |||||||| ||||||| |||| |||||||| ||| |||| |||||||||||| ||| | || | |
|
|
| T |
36836037 |
actaaaaatagtcactttacaaagtatttaaataattcaaagtatattatagcaggggttggttctgaagatgattggatggttcttattattagcacta |
36836136 |
T |
|
| Q |
105 |
acacagcttctggagatttttcttctgctacttatttgctt |
145 |
Q |
| |
|
||||| |||||||||||||||||||||||| || ||||||| |
|
|
| T |
36836137 |
acacaacttctggagatttttcttctgctaattctttgctt |
36836177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1781 times since January 2019
Visitors: 6150